Review



lentiviral vector plko 1 shrna control shctrl  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc lentiviral vector plko 1 shrna control shctrl
    Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 367 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector plko 1 shrna control shctrl/product/Addgene inc
    Average 96 stars, based on 367 article reviews
    lentiviral vector plko 1 shrna control shctrl - by Bioz Stars, 2026-05
    96/100 stars

    Images



    Similar Products

    96
    Santa Cruz Biotechnology nontargeted shctrl
    Nontargeted Shctrl, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nontargeted shctrl/product/Santa Cruz Biotechnology
    Average 96 stars, based on 1 article reviews
    nontargeted shctrl - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    96
    Addgene inc lentiviral vector plko 1 shrna control shctrl
    Lentiviral Vector Plko 1 Shrna Control Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vector plko 1 shrna control shctrl/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    lentiviral vector plko 1 shrna control shctrl - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    94
    Addgene inc mesv shctrl gfp
    a , E-STUB assay and label-free mass spectrometry were used to identify KLHL6-proximal ubiquitylated substrates. Fold changes in protein abundance between KLHL6-BirA and Empty-BirA groups were calculated by two-sided moderated t -test (limma). b , Interaction between endogenous KLHL6 and TOX in human T cells. c , Cycloheximide (CHX) chase assay showing TOX degradation in Jurkat cells transduced with empty or KLHL6-Myc vectors ( n = 3 independent samples). d , TOX levels in WT or Klhl6 −/− OT-I T cells with or without anti-CD3 restimulation ( n = 3 independent samples). e , Quantification of endogenous TOX protein in Jurkat cells transduced with an empty vector or KLHL6-Myc, with or without MG132 treatment (10 μM, 6 h; n = 3 independent samples). f , g , Ubiquitination of endogenous TOX in KLHL6-overexpressing human T cells ( f ) and in mouse Klhl6 −/− CD8 + T cells ( g ). h , Violin plots showing the TOX and TCF-1 signatures in transferred Control and KLHL6-OE TILs from scRNA-seq data in Fig. . The boxplot spans from the first to the third quartile of the distribution, with the median positioned in the centre. Whiskers represent the minimum and maximum values, excluding outliers. Values plotted represent cells from a single replicate. i – k , OT-I CD8 + T cells from CD45.1 + WT or KO donor mice were transduced with <t>shCtrl</t> or shTox retrovirus and adoptively transferred (4 × 10 6 ) into B16-OVA tumour-bearing mice. The mice were euthanized at day 14 for analysis after adoptive transfer ( n = 8 mice). Percentages ( i ) and absolute numbers ( j ) of Tex term (Ly108 − TIM-3 + ) and Tpex (Ly108 + TIM-3 − ) subsets, and tumour weights ( k ) were assessed. l , Correlation of KLHL6 expression with Tpex, Tex term and TOX signatures in human CD8 + TILs from human pan-cancer scRNA-seq data. For immunoblot source data, see Supplementary Fig. . Illustration in l created in BioRender. Li, G. (2025) https://BioRender.com/p3754eu . Data in b , f , g are representative of three independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( c – e , i – k ). * P < 0.05, ** P < 0.01, *** P < 0.001 and **** P < 0.0001; NS, not significant. IP, immunoprecipitation.
    Mesv Shctrl Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mesv shctrl gfp/product/Addgene inc
    Average 94 stars, based on 1 article reviews
    mesv shctrl gfp - by Bioz Stars, 2026-05
    94/100 stars
      Buy from Supplier

    96
    Addgene inc non targeting control shrna shctrl
    a , E-STUB assay and label-free mass spectrometry were used to identify KLHL6-proximal ubiquitylated substrates. Fold changes in protein abundance between KLHL6-BirA and Empty-BirA groups were calculated by two-sided moderated t -test (limma). b , Interaction between endogenous KLHL6 and TOX in human T cells. c , Cycloheximide (CHX) chase assay showing TOX degradation in Jurkat cells transduced with empty or KLHL6-Myc vectors ( n = 3 independent samples). d , TOX levels in WT or Klhl6 −/− OT-I T cells with or without anti-CD3 restimulation ( n = 3 independent samples). e , Quantification of endogenous TOX protein in Jurkat cells transduced with an empty vector or KLHL6-Myc, with or without MG132 treatment (10 μM, 6 h; n = 3 independent samples). f , g , Ubiquitination of endogenous TOX in KLHL6-overexpressing human T cells ( f ) and in mouse Klhl6 −/− CD8 + T cells ( g ). h , Violin plots showing the TOX and TCF-1 signatures in transferred Control and KLHL6-OE TILs from scRNA-seq data in Fig. . The boxplot spans from the first to the third quartile of the distribution, with the median positioned in the centre. Whiskers represent the minimum and maximum values, excluding outliers. Values plotted represent cells from a single replicate. i – k , OT-I CD8 + T cells from CD45.1 + WT or KO donor mice were transduced with <t>shCtrl</t> or shTox retrovirus and adoptively transferred (4 × 10 6 ) into B16-OVA tumour-bearing mice. The mice were euthanized at day 14 for analysis after adoptive transfer ( n = 8 mice). Percentages ( i ) and absolute numbers ( j ) of Tex term (Ly108 − TIM-3 + ) and Tpex (Ly108 + TIM-3 − ) subsets, and tumour weights ( k ) were assessed. l , Correlation of KLHL6 expression with Tpex, Tex term and TOX signatures in human CD8 + TILs from human pan-cancer scRNA-seq data. For immunoblot source data, see Supplementary Fig. . Illustration in l created in BioRender. Li, G. (2025) https://BioRender.com/p3754eu . Data in b , f , g are representative of three independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( c – e , i – k ). * P < 0.05, ** P < 0.01, *** P < 0.001 and **** P < 0.0001; NS, not significant. IP, immunoprecipitation.
    Non Targeting Control Shrna Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non targeting control shrna shctrl/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    non targeting control shrna shctrl - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    98
    Addgene inc trcn0000084441 shctrl trcn0000087723 pmd2 g plasmid addgene
    a , E-STUB assay and label-free mass spectrometry were used to identify KLHL6-proximal ubiquitylated substrates. Fold changes in protein abundance between KLHL6-BirA and Empty-BirA groups were calculated by two-sided moderated t -test (limma). b , Interaction between endogenous KLHL6 and TOX in human T cells. c , Cycloheximide (CHX) chase assay showing TOX degradation in Jurkat cells transduced with empty or KLHL6-Myc vectors ( n = 3 independent samples). d , TOX levels in WT or Klhl6 −/− OT-I T cells with or without anti-CD3 restimulation ( n = 3 independent samples). e , Quantification of endogenous TOX protein in Jurkat cells transduced with an empty vector or KLHL6-Myc, with or without MG132 treatment (10 μM, 6 h; n = 3 independent samples). f , g , Ubiquitination of endogenous TOX in KLHL6-overexpressing human T cells ( f ) and in mouse Klhl6 −/− CD8 + T cells ( g ). h , Violin plots showing the TOX and TCF-1 signatures in transferred Control and KLHL6-OE TILs from scRNA-seq data in Fig. . The boxplot spans from the first to the third quartile of the distribution, with the median positioned in the centre. Whiskers represent the minimum and maximum values, excluding outliers. Values plotted represent cells from a single replicate. i – k , OT-I CD8 + T cells from CD45.1 + WT or KO donor mice were transduced with <t>shCtrl</t> or shTox retrovirus and adoptively transferred (4 × 10 6 ) into B16-OVA tumour-bearing mice. The mice were euthanized at day 14 for analysis after adoptive transfer ( n = 8 mice). Percentages ( i ) and absolute numbers ( j ) of Tex term (Ly108 − TIM-3 + ) and Tpex (Ly108 + TIM-3 − ) subsets, and tumour weights ( k ) were assessed. l , Correlation of KLHL6 expression with Tpex, Tex term and TOX signatures in human CD8 + TILs from human pan-cancer scRNA-seq data. For immunoblot source data, see Supplementary Fig. . Illustration in l created in BioRender. Li, G. (2025) https://BioRender.com/p3754eu . Data in b , f , g are representative of three independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( c – e , i – k ). * P < 0.05, ** P < 0.01, *** P < 0.001 and **** P < 0.0001; NS, not significant. IP, immunoprecipitation.
    Trcn0000084441 Shctrl Trcn0000087723 Pmd2 G Plasmid Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trcn0000084441 shctrl trcn0000087723 pmd2 g plasmid addgene/product/Addgene inc
    Average 98 stars, based on 1 article reviews
    trcn0000084441 shctrl trcn0000087723 pmd2 g plasmid addgene - by Bioz Stars, 2026-05
    98/100 stars
      Buy from Supplier

    96
    Addgene inc rna vector shctrl
    a , E-STUB assay and label-free mass spectrometry were used to identify KLHL6-proximal ubiquitylated substrates. Fold changes in protein abundance between KLHL6-BirA and Empty-BirA groups were calculated by two-sided moderated t -test (limma). b , Interaction between endogenous KLHL6 and TOX in human T cells. c , Cycloheximide (CHX) chase assay showing TOX degradation in Jurkat cells transduced with empty or KLHL6-Myc vectors ( n = 3 independent samples). d , TOX levels in WT or Klhl6 −/− OT-I T cells with or without anti-CD3 restimulation ( n = 3 independent samples). e , Quantification of endogenous TOX protein in Jurkat cells transduced with an empty vector or KLHL6-Myc, with or without MG132 treatment (10 μM, 6 h; n = 3 independent samples). f , g , Ubiquitination of endogenous TOX in KLHL6-overexpressing human T cells ( f ) and in mouse Klhl6 −/− CD8 + T cells ( g ). h , Violin plots showing the TOX and TCF-1 signatures in transferred Control and KLHL6-OE TILs from scRNA-seq data in Fig. . The boxplot spans from the first to the third quartile of the distribution, with the median positioned in the centre. Whiskers represent the minimum and maximum values, excluding outliers. Values plotted represent cells from a single replicate. i – k , OT-I CD8 + T cells from CD45.1 + WT or KO donor mice were transduced with <t>shCtrl</t> or shTox retrovirus and adoptively transferred (4 × 10 6 ) into B16-OVA tumour-bearing mice. The mice were euthanized at day 14 for analysis after adoptive transfer ( n = 8 mice). Percentages ( i ) and absolute numbers ( j ) of Tex term (Ly108 − TIM-3 + ) and Tpex (Ly108 + TIM-3 − ) subsets, and tumour weights ( k ) were assessed. l , Correlation of KLHL6 expression with Tpex, Tex term and TOX signatures in human CD8 + TILs from human pan-cancer scRNA-seq data. For immunoblot source data, see Supplementary Fig. . Illustration in l created in BioRender. Li, G. (2025) https://BioRender.com/p3754eu . Data in b , f , g are representative of three independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( c – e , i – k ). * P < 0.05, ** P < 0.01, *** P < 0.001 and **** P < 0.0001; NS, not significant. IP, immunoprecipitation.
    Rna Vector Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna vector shctrl/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    rna vector shctrl - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    95
    Addgene inc aav shctrl
    a , E-STUB assay and label-free mass spectrometry were used to identify KLHL6-proximal ubiquitylated substrates. Fold changes in protein abundance between KLHL6-BirA and Empty-BirA groups were calculated by two-sided moderated t -test (limma). b , Interaction between endogenous KLHL6 and TOX in human T cells. c , Cycloheximide (CHX) chase assay showing TOX degradation in Jurkat cells transduced with empty or KLHL6-Myc vectors ( n = 3 independent samples). d , TOX levels in WT or Klhl6 −/− OT-I T cells with or without anti-CD3 restimulation ( n = 3 independent samples). e , Quantification of endogenous TOX protein in Jurkat cells transduced with an empty vector or KLHL6-Myc, with or without MG132 treatment (10 μM, 6 h; n = 3 independent samples). f , g , Ubiquitination of endogenous TOX in KLHL6-overexpressing human T cells ( f ) and in mouse Klhl6 −/− CD8 + T cells ( g ). h , Violin plots showing the TOX and TCF-1 signatures in transferred Control and KLHL6-OE TILs from scRNA-seq data in Fig. . The boxplot spans from the first to the third quartile of the distribution, with the median positioned in the centre. Whiskers represent the minimum and maximum values, excluding outliers. Values plotted represent cells from a single replicate. i – k , OT-I CD8 + T cells from CD45.1 + WT or KO donor mice were transduced with <t>shCtrl</t> or shTox retrovirus and adoptively transferred (4 × 10 6 ) into B16-OVA tumour-bearing mice. The mice were euthanized at day 14 for analysis after adoptive transfer ( n = 8 mice). Percentages ( i ) and absolute numbers ( j ) of Tex term (Ly108 − TIM-3 + ) and Tpex (Ly108 + TIM-3 − ) subsets, and tumour weights ( k ) were assessed. l , Correlation of KLHL6 expression with Tpex, Tex term and TOX signatures in human CD8 + TILs from human pan-cancer scRNA-seq data. For immunoblot source data, see Supplementary Fig. . Illustration in l created in BioRender. Li, G. (2025) https://BioRender.com/p3754eu . Data in b , f , g are representative of three independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( c – e , i – k ). * P < 0.05, ** P < 0.01, *** P < 0.001 and **** P < 0.0001; NS, not significant. IP, immunoprecipitation.
    Aav Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/aav shctrl/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    aav shctrl - by Bioz Stars, 2026-05
    95/100 stars
      Buy from Supplier

    93
    Addgene inc lentiviral constructs plko rfp shctrl
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Lentiviral Constructs Plko Rfp Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral constructs plko rfp shctrl/product/Addgene inc
    Average 93 stars, based on 1 article reviews
    lentiviral constructs plko rfp shctrl - by Bioz Stars, 2026-05
    93/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 shctrl
    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a <t>lentiviral</t> vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).
    Plko 1 Shctrl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 shctrl/product/Addgene inc
    Average 96 stars, based on 1 article reviews
    plko 1 shctrl - by Bioz Stars, 2026-05
    96/100 stars
      Buy from Supplier

    Image Search Results


    a , E-STUB assay and label-free mass spectrometry were used to identify KLHL6-proximal ubiquitylated substrates. Fold changes in protein abundance between KLHL6-BirA and Empty-BirA groups were calculated by two-sided moderated t -test (limma). b , Interaction between endogenous KLHL6 and TOX in human T cells. c , Cycloheximide (CHX) chase assay showing TOX degradation in Jurkat cells transduced with empty or KLHL6-Myc vectors ( n = 3 independent samples). d , TOX levels in WT or Klhl6 −/− OT-I T cells with or without anti-CD3 restimulation ( n = 3 independent samples). e , Quantification of endogenous TOX protein in Jurkat cells transduced with an empty vector or KLHL6-Myc, with or without MG132 treatment (10 μM, 6 h; n = 3 independent samples). f , g , Ubiquitination of endogenous TOX in KLHL6-overexpressing human T cells ( f ) and in mouse Klhl6 −/− CD8 + T cells ( g ). h , Violin plots showing the TOX and TCF-1 signatures in transferred Control and KLHL6-OE TILs from scRNA-seq data in Fig. . The boxplot spans from the first to the third quartile of the distribution, with the median positioned in the centre. Whiskers represent the minimum and maximum values, excluding outliers. Values plotted represent cells from a single replicate. i – k , OT-I CD8 + T cells from CD45.1 + WT or KO donor mice were transduced with shCtrl or shTox retrovirus and adoptively transferred (4 × 10 6 ) into B16-OVA tumour-bearing mice. The mice were euthanized at day 14 for analysis after adoptive transfer ( n = 8 mice). Percentages ( i ) and absolute numbers ( j ) of Tex term (Ly108 − TIM-3 + ) and Tpex (Ly108 + TIM-3 − ) subsets, and tumour weights ( k ) were assessed. l , Correlation of KLHL6 expression with Tpex, Tex term and TOX signatures in human CD8 + TILs from human pan-cancer scRNA-seq data. For immunoblot source data, see Supplementary Fig. . Illustration in l created in BioRender. Li, G. (2025) https://BioRender.com/p3754eu . Data in b , f , g are representative of three independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( c – e , i – k ). * P < 0.05, ** P < 0.01, *** P < 0.001 and **** P < 0.0001; NS, not significant. IP, immunoprecipitation.

    Journal: Nature

    Article Title: The ubiquitin ligase KLHL6 drives resistance to CD8 + T cell dysfunction

    doi: 10.1038/s41586-025-09926-8

    Figure Lengend Snippet: a , E-STUB assay and label-free mass spectrometry were used to identify KLHL6-proximal ubiquitylated substrates. Fold changes in protein abundance between KLHL6-BirA and Empty-BirA groups were calculated by two-sided moderated t -test (limma). b , Interaction between endogenous KLHL6 and TOX in human T cells. c , Cycloheximide (CHX) chase assay showing TOX degradation in Jurkat cells transduced with empty or KLHL6-Myc vectors ( n = 3 independent samples). d , TOX levels in WT or Klhl6 −/− OT-I T cells with or without anti-CD3 restimulation ( n = 3 independent samples). e , Quantification of endogenous TOX protein in Jurkat cells transduced with an empty vector or KLHL6-Myc, with or without MG132 treatment (10 μM, 6 h; n = 3 independent samples). f , g , Ubiquitination of endogenous TOX in KLHL6-overexpressing human T cells ( f ) and in mouse Klhl6 −/− CD8 + T cells ( g ). h , Violin plots showing the TOX and TCF-1 signatures in transferred Control and KLHL6-OE TILs from scRNA-seq data in Fig. . The boxplot spans from the first to the third quartile of the distribution, with the median positioned in the centre. Whiskers represent the minimum and maximum values, excluding outliers. Values plotted represent cells from a single replicate. i – k , OT-I CD8 + T cells from CD45.1 + WT or KO donor mice were transduced with shCtrl or shTox retrovirus and adoptively transferred (4 × 10 6 ) into B16-OVA tumour-bearing mice. The mice were euthanized at day 14 for analysis after adoptive transfer ( n = 8 mice). Percentages ( i ) and absolute numbers ( j ) of Tex term (Ly108 − TIM-3 + ) and Tpex (Ly108 + TIM-3 − ) subsets, and tumour weights ( k ) were assessed. l , Correlation of KLHL6 expression with Tpex, Tex term and TOX signatures in human CD8 + TILs from human pan-cancer scRNA-seq data. For immunoblot source data, see Supplementary Fig. . Illustration in l created in BioRender. Li, G. (2025) https://BioRender.com/p3754eu . Data in b , f , g are representative of three independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( c – e , i – k ). * P < 0.05, ** P < 0.01, *** P < 0.001 and **** P < 0.0001; NS, not significant. IP, immunoprecipitation.

    Article Snippet: The MESV- shCtrl -GFP (Addgene, 85587) was used for Tox or Pgam5 KD.

    Techniques: Mass Spectrometry, Quantitative Proteomics, Transduction, Plasmid Preparation, Ubiquitin Proteomics, Control, Adoptive Transfer Assay, Expressing, Western Blot, Immunoprecipitation

    a , Gating strategy, histogram plots, and quantification of TIM-3 and TCF-1 levels in TOX lo PD-1 lo , TOX lo PD-1 hi , and TOX hi PD-1 hi OT-I TIL populations from B16-OVA tumours at day 14 post-transfer (n = 7 mice). b , Percentages of Tpex (Ly108 + TIM-3 − ) and Tex term (Ly108 − TIM-3 + ) populations in TOX lo and TOX hi TILs at day 14 (n = 7 mice). c , d , Numbers of CD45.1 + OT-I TILs ( c ) and TOX expression levels ( d ) in WT+ shCtrl , KO+ shCtrl , and KO+ shTox groups at day 14 after ACT (n = 8 mice). e , Correlation between KLHL6 expression and the indicated genes in human TILs from melanoma, renal cancer, breast cancer, and nasopharyngeal cancer, using human pan-cancer scRNA-seq data. CD8 + TILs were stratified into KLHL6 hi and KLHL6 lo groups. Selected genes were quantified and visualized with red indicating highly expressed and blue indicating lower expressed. f-k , Naïve CD8 + OT-I T cells were activated with anti-CD3/CD28 for 24 h, and transduced with TOX(WT) (TOX WT -OE), TOX(4KR) (TOX 4KR -OE) or Empty vector (Control). Cells were cultured for 5 days in vitro before subsequent analyses. Experimental design ( f ), percentages of PD-1 + LAG-3 + populations ( g ), TOX, PD-1, and LAG-3 levels ( h ), cytokine production ( i ), heatmap of differentially expressed genes ( j ), and GSEA for exhaustion and effector signatures ( k ) (n = 3 independent samples). GSEA uses a one-sided, permutation-based modified K–S test with adjustments for multiple comparisons. l - o , 3×10 6 Control, TOX(WT), or TOX(4KR) OT-I T cells were adoptively transferred into B16-OVA tumour-bearing mice. Mice were sacrificed on day 14 after ACT. TOX expression ( l ), percentages of PD-1 − TIM-3 − , PD-1 + TIM-3 − and PD-1 + TIM-3 + populations ( m ), MFI of LAG-3, TIM-3, and PD-1 ( n ), and cytokine production ( o ) in CD45.1 + CD8 + TILs were assessed (n = 6 mice). Diagram in e created in BioRender. Li, G. (2025) https://BioRender.com/p3754eu . Diagram in f created in BioRender. Li, G. (2025) https://BioRender.com/ahcb92h . Data are presented as mean ± s.e.m. Statistical analyses were performed by two-way ANOVA with Sidak’s multiple-comparisons test ( b ) or with Tukey’s multiple-comparisons test ( a , c , d , g-i , l-o ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.

    Journal: Nature

    Article Title: The ubiquitin ligase KLHL6 drives resistance to CD8 + T cell dysfunction

    doi: 10.1038/s41586-025-09926-8

    Figure Lengend Snippet: a , Gating strategy, histogram plots, and quantification of TIM-3 and TCF-1 levels in TOX lo PD-1 lo , TOX lo PD-1 hi , and TOX hi PD-1 hi OT-I TIL populations from B16-OVA tumours at day 14 post-transfer (n = 7 mice). b , Percentages of Tpex (Ly108 + TIM-3 − ) and Tex term (Ly108 − TIM-3 + ) populations in TOX lo and TOX hi TILs at day 14 (n = 7 mice). c , d , Numbers of CD45.1 + OT-I TILs ( c ) and TOX expression levels ( d ) in WT+ shCtrl , KO+ shCtrl , and KO+ shTox groups at day 14 after ACT (n = 8 mice). e , Correlation between KLHL6 expression and the indicated genes in human TILs from melanoma, renal cancer, breast cancer, and nasopharyngeal cancer, using human pan-cancer scRNA-seq data. CD8 + TILs were stratified into KLHL6 hi and KLHL6 lo groups. Selected genes were quantified and visualized with red indicating highly expressed and blue indicating lower expressed. f-k , Naïve CD8 + OT-I T cells were activated with anti-CD3/CD28 for 24 h, and transduced with TOX(WT) (TOX WT -OE), TOX(4KR) (TOX 4KR -OE) or Empty vector (Control). Cells were cultured for 5 days in vitro before subsequent analyses. Experimental design ( f ), percentages of PD-1 + LAG-3 + populations ( g ), TOX, PD-1, and LAG-3 levels ( h ), cytokine production ( i ), heatmap of differentially expressed genes ( j ), and GSEA for exhaustion and effector signatures ( k ) (n = 3 independent samples). GSEA uses a one-sided, permutation-based modified K–S test with adjustments for multiple comparisons. l - o , 3×10 6 Control, TOX(WT), or TOX(4KR) OT-I T cells were adoptively transferred into B16-OVA tumour-bearing mice. Mice were sacrificed on day 14 after ACT. TOX expression ( l ), percentages of PD-1 − TIM-3 − , PD-1 + TIM-3 − and PD-1 + TIM-3 + populations ( m ), MFI of LAG-3, TIM-3, and PD-1 ( n ), and cytokine production ( o ) in CD45.1 + CD8 + TILs were assessed (n = 6 mice). Diagram in e created in BioRender. Li, G. (2025) https://BioRender.com/p3754eu . Diagram in f created in BioRender. Li, G. (2025) https://BioRender.com/ahcb92h . Data are presented as mean ± s.e.m. Statistical analyses were performed by two-way ANOVA with Sidak’s multiple-comparisons test ( b ) or with Tukey’s multiple-comparisons test ( a , c , d , g-i , l-o ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.

    Article Snippet: The MESV- shCtrl -GFP (Addgene, 85587) was used for Tox or Pgam5 KD.

    Techniques: Expressing, Transduction, Plasmid Preparation, Control, Cell Culture, In Vitro, Modification

    a , Representative mitochondrial morphology, individual mitochondrial area ( n = 218) and total crista length per mitochondrion ( n = 60 cells) in WT and KO OT-I T cells. b – f , CD8 + WT and KLHL6 KO OT-I T cells transduced with shPgam5 ( shP5 ) or shCtrl retrovirus were cultured for 6 days in vitro. b , Immunoblots of indicated proteins. c – f , OCR ( c , d ), SRC ( e ) and mitochondrial ATP production ( f ) were assessed ( n = 9 tests). g – i , CD45.1/2 + WT and CD45.1 + KO OT-I T cells transduced with either GFP- shCtrl or Thy1.1- shPgam5 ( shP5 ) were mixed equally (1:1:1:1) and cotransferred into CD45.2 + mice bearing B16-OVA tumours. Mice were analysed on day 14 post-ACT ( n = 7 mice). Percentages of TNF + IFNγ + CD8 + TILs ( g ), frequencies ( h ) and cell numbers ( i ) of Tpex (Ly108 + TIM-3 − ) and Tex term (Ly108 − TIM-3 + ) subsets were assessed. j , k , Tumour volume ( j ) and survival curves ( k ) of tumour-bearing mice following separate transfer of 5 × 10 6 indicated cells were recorded ( n = 10 mice). Mice with tumour volumes greater than 1,500 mm 3 were euthanized and this was defined as death. l , m , 4 × 10 6 WT + Empty, WT + PGC1α, KO + Empty or KO + PGC1α OT-I T cells were adoptively transferred into B16-OVA tumour-bearing mice. Mice were analysed at day 14 post-ACT for the frequencies and numbers of Tpex and Tex term cells ( l ), and cytokine production ( m ) ( n = 6 mice). n , o , CD45.1 + WT and KO OT-I T cells were transduced with either shCtrl , shPgam5 ( shP5 ), shTox or a combination of shPgam5 and shTox ( shP5 + shTox ) retrovirus. A total of 4 × 10 6 cells from each group were transferred into CD45.2 + B16-OVA tumour-bearing mice. Tpex and Tex term subsets ( n ) and cytokine production ( o ) in CD8 + TILs were assessed on day 14 post-ACT ( n = 6 mice). For immunoblot source data, see Supplementary Fig. . Experiments in a , b were repeated three times. Data in n , o are representative of two independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by unpaired two-tailed Student’s t -test ( a ), two-way ANOVA with Tukey’s multiple-comparisons test ( d – j , l – o ), and log-rank (Mantel–Cox) test ( k ). * P < 0.05, ** P < 0.01, *** P < 0.001 and **** P < 0.0001; NS, not significant. Scale bar, 1 μm.

    Journal: Nature

    Article Title: The ubiquitin ligase KLHL6 drives resistance to CD8 + T cell dysfunction

    doi: 10.1038/s41586-025-09926-8

    Figure Lengend Snippet: a , Representative mitochondrial morphology, individual mitochondrial area ( n = 218) and total crista length per mitochondrion ( n = 60 cells) in WT and KO OT-I T cells. b – f , CD8 + WT and KLHL6 KO OT-I T cells transduced with shPgam5 ( shP5 ) or shCtrl retrovirus were cultured for 6 days in vitro. b , Immunoblots of indicated proteins. c – f , OCR ( c , d ), SRC ( e ) and mitochondrial ATP production ( f ) were assessed ( n = 9 tests). g – i , CD45.1/2 + WT and CD45.1 + KO OT-I T cells transduced with either GFP- shCtrl or Thy1.1- shPgam5 ( shP5 ) were mixed equally (1:1:1:1) and cotransferred into CD45.2 + mice bearing B16-OVA tumours. Mice were analysed on day 14 post-ACT ( n = 7 mice). Percentages of TNF + IFNγ + CD8 + TILs ( g ), frequencies ( h ) and cell numbers ( i ) of Tpex (Ly108 + TIM-3 − ) and Tex term (Ly108 − TIM-3 + ) subsets were assessed. j , k , Tumour volume ( j ) and survival curves ( k ) of tumour-bearing mice following separate transfer of 5 × 10 6 indicated cells were recorded ( n = 10 mice). Mice with tumour volumes greater than 1,500 mm 3 were euthanized and this was defined as death. l , m , 4 × 10 6 WT + Empty, WT + PGC1α, KO + Empty or KO + PGC1α OT-I T cells were adoptively transferred into B16-OVA tumour-bearing mice. Mice were analysed at day 14 post-ACT for the frequencies and numbers of Tpex and Tex term cells ( l ), and cytokine production ( m ) ( n = 6 mice). n , o , CD45.1 + WT and KO OT-I T cells were transduced with either shCtrl , shPgam5 ( shP5 ), shTox or a combination of shPgam5 and shTox ( shP5 + shTox ) retrovirus. A total of 4 × 10 6 cells from each group were transferred into CD45.2 + B16-OVA tumour-bearing mice. Tpex and Tex term subsets ( n ) and cytokine production ( o ) in CD8 + TILs were assessed on day 14 post-ACT ( n = 6 mice). For immunoblot source data, see Supplementary Fig. . Experiments in a , b were repeated three times. Data in n , o are representative of two independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by unpaired two-tailed Student’s t -test ( a ), two-way ANOVA with Tukey’s multiple-comparisons test ( d – j , l – o ), and log-rank (Mantel–Cox) test ( k ). * P < 0.05, ** P < 0.01, *** P < 0.001 and **** P < 0.0001; NS, not significant. Scale bar, 1 μm.

    Article Snippet: The MESV- shCtrl -GFP (Addgene, 85587) was used for Tox or Pgam5 KD.

    Techniques: Transduction, Cell Culture, In Vitro, Western Blot, Two Tailed Test

    a , Immunoblot of mitochondrial fusion/fission proteins in WT or KLHL6 KO OT-I T cells activated by anti-CD3/CD28 for indicated times (n = 3 independent samples). b , Immunoblot of p62 and LC3 (upper band: LC3-I; lower band: LC3-II) in WT and KO OT-I T cells at day 5 post-activation. c , CD45.2 + B16-OVA-bearing mice received 4×10 6 WT or KO CD45.1 + OT-I cells pretreated with DMSO or M1 (20 μM) + Mdivi-1 (10 μM) (MM) for 3 days. Survival of mice was monitored (n = 8 mice). d , Interaction between introduced KLHL6-Myc and endogenous PGAM5 in Jurkat cells. e , Ubiquitination of endogenous PGAM5 in Jurkat cells transduced with KLHL6-Myc. f , g , Immunoblot analysis of endogenous PGAM5 in Jurkat cells expressing an empty vector or KLHL6-Myc with or without MG132 treatment ( f ) and in WT and KO T cells collected at different time points after activation ( g ). h , i , WT and KLHL6 KO OT-I T cells transduced with shPgam5 ( shP5 ) or shCtrl retrovirus were cultured in vitro for 5 days. TMRE/MTG ratio ( h , n = 5 independent samples) and mitochondrial morphology and area ( i ; scale bar, 1 μm; n = 60 cells) were analyzed. j-m , CD45.1/2 + WT and CD45.1 + KLHL6 KO OT-I T cells transduced with GFP- shCtrl or Thy1.1- shPgam5 ( shP5 ) were mixed at a 1:1:1:1 ratio and cotransferred into CD45.2 + B16-OVA tumour-bearing mice. Mice were sacrificed for analysis on day 14 after ACT. Experimental design ( j ), CD8 + TIL numbers ( k ), PD-1 and TIM-3 expression in TILs ( l ), and numbers of CD44 + CD62L + cells in dLN and spleen from the four groups ( m ) (n = 7 mice). n-r , WT and KO OT-I T cells were activated and cultured for 3 days in vitro, then treated with DMSO or the PGAM5 inhibitor LFHP-1c (P5i, 2 μM) for another 3 days before analysis. Immunoblotting of Mfn2, Opa1, Drp1, p-Drp1 S637 , PGAM5, and Actin ( n ). OCR, SRC, mitochondrial ATP production ( o - q , n = 10 tests), and TMRE/MTG ratio ( r , n = 3 independent samples) were assessed. s-y , CD45.2 + mice bearing B16-OVA tumours received 4×10 6 activated WT or KO CD45.1 + OT-I cells pretreated with DMSO or P5i. The mice were sacrificed for analysis at day 14 after ACT. Schematic of the experiment ( s ), tumour weights ( t ), total numbers ( u ), cytokine production ( v ), PD-1 and TIM-3 levels ( w ), and cell numbers of indicated subsets ( x ) of OT-I TILs were evaluated (n = 6 mice); percentages of T CM populations in dLN and spleen ( y , n = 6 mice). Diagram in j created in BioRender. Li, G. (2025) https://BioRender.com/md3c1bz . Diagram in s created in BioRender. Li, G. (2025) https://BioRender.com/ap5vq6h . Data in ( b , d - g , n ) are representative of three independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( a , h , i , k - m , o-r , t-y ) and Log-rank (Mantel-Cox) test ( c ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.

    Journal: Nature

    Article Title: The ubiquitin ligase KLHL6 drives resistance to CD8 + T cell dysfunction

    doi: 10.1038/s41586-025-09926-8

    Figure Lengend Snippet: a , Immunoblot of mitochondrial fusion/fission proteins in WT or KLHL6 KO OT-I T cells activated by anti-CD3/CD28 for indicated times (n = 3 independent samples). b , Immunoblot of p62 and LC3 (upper band: LC3-I; lower band: LC3-II) in WT and KO OT-I T cells at day 5 post-activation. c , CD45.2 + B16-OVA-bearing mice received 4×10 6 WT or KO CD45.1 + OT-I cells pretreated with DMSO or M1 (20 μM) + Mdivi-1 (10 μM) (MM) for 3 days. Survival of mice was monitored (n = 8 mice). d , Interaction between introduced KLHL6-Myc and endogenous PGAM5 in Jurkat cells. e , Ubiquitination of endogenous PGAM5 in Jurkat cells transduced with KLHL6-Myc. f , g , Immunoblot analysis of endogenous PGAM5 in Jurkat cells expressing an empty vector or KLHL6-Myc with or without MG132 treatment ( f ) and in WT and KO T cells collected at different time points after activation ( g ). h , i , WT and KLHL6 KO OT-I T cells transduced with shPgam5 ( shP5 ) or shCtrl retrovirus were cultured in vitro for 5 days. TMRE/MTG ratio ( h , n = 5 independent samples) and mitochondrial morphology and area ( i ; scale bar, 1 μm; n = 60 cells) were analyzed. j-m , CD45.1/2 + WT and CD45.1 + KLHL6 KO OT-I T cells transduced with GFP- shCtrl or Thy1.1- shPgam5 ( shP5 ) were mixed at a 1:1:1:1 ratio and cotransferred into CD45.2 + B16-OVA tumour-bearing mice. Mice were sacrificed for analysis on day 14 after ACT. Experimental design ( j ), CD8 + TIL numbers ( k ), PD-1 and TIM-3 expression in TILs ( l ), and numbers of CD44 + CD62L + cells in dLN and spleen from the four groups ( m ) (n = 7 mice). n-r , WT and KO OT-I T cells were activated and cultured for 3 days in vitro, then treated with DMSO or the PGAM5 inhibitor LFHP-1c (P5i, 2 μM) for another 3 days before analysis. Immunoblotting of Mfn2, Opa1, Drp1, p-Drp1 S637 , PGAM5, and Actin ( n ). OCR, SRC, mitochondrial ATP production ( o - q , n = 10 tests), and TMRE/MTG ratio ( r , n = 3 independent samples) were assessed. s-y , CD45.2 + mice bearing B16-OVA tumours received 4×10 6 activated WT or KO CD45.1 + OT-I cells pretreated with DMSO or P5i. The mice were sacrificed for analysis at day 14 after ACT. Schematic of the experiment ( s ), tumour weights ( t ), total numbers ( u ), cytokine production ( v ), PD-1 and TIM-3 levels ( w ), and cell numbers of indicated subsets ( x ) of OT-I TILs were evaluated (n = 6 mice); percentages of T CM populations in dLN and spleen ( y , n = 6 mice). Diagram in j created in BioRender. Li, G. (2025) https://BioRender.com/md3c1bz . Diagram in s created in BioRender. Li, G. (2025) https://BioRender.com/ap5vq6h . Data in ( b , d - g , n ) are representative of three independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( a , h , i , k - m , o-r , t-y ) and Log-rank (Mantel-Cox) test ( c ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.

    Article Snippet: The MESV- shCtrl -GFP (Addgene, 85587) was used for Tox or Pgam5 KD.

    Techniques: Western Blot, Activation Assay, Ubiquitin Proteomics, Transduction, Expressing, Plasmid Preparation, Cell Culture, In Vitro

    a , b , CD8 + WT and KLHL6 KO T cells transduced with either Empty vector (Empty) or PGC1α-overexpression (PGC1α) plasmids were cultured for 6 days. OCR ( a , n = 10 tests) and SRC and mitochondrial ATP production ( b , n = 10 tests) were measured. c - e , Tumour weights ( c ), absolute numbers of transferred CD8 + TILs ( d ), and proportion of damaged mitochondria in transferred CD8 + TILs ( e ) were assessed in the indicated groups (n = 6 mice), related to Fig. . f - i , Experimental design related to Fig. ( f ), tumour weights ( g ), absolute numbers of total ( h ) and Tpex (Ly108 + TIM-3 − ) and Tex term (Ly108 − TIM-3 + ) subsets ( i ) of transferred CD8 + TILs among the five groups at day 14 after ACT (n = 6 mice). j - n , CD8 + OT-I T cells transduced with either TOX-overexpressing (TOX-OE) or Empty vector (Control) retrovirus were cultured for 5 days in vitro, and then restimulated with or without CD3 antibody for 24 h before analysis. Representative plots and quantification of mitochondrial depolarization (TMRE/MTG) lo ( j ) and MitoSOX level ( k ) were assessed (n = 3 independent samples). OCR ( l ), SRC (left) and mitochondrial ATP production (right) ( m ), and glycoPER ( n ) were measured (n = 10 tests). o , p , Activated WT and KO CD8 + OT-I T cells were transduced with either shCtrl or shTox retrovirus at 24 h post-activation and cultured for an additional 5 days prior to analysis. OCR ( o ), SRC (left) and mitochondrial ATP production (right) ( p ) were measured (n = 8 tests). Diagram in f created in BioRender. Li, G. (2025) https://BioRender.com/md3c1bz . Data in ( f - i ) are representative of two independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( a - e , g - p ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.

    Journal: Nature

    Article Title: The ubiquitin ligase KLHL6 drives resistance to CD8 + T cell dysfunction

    doi: 10.1038/s41586-025-09926-8

    Figure Lengend Snippet: a , b , CD8 + WT and KLHL6 KO T cells transduced with either Empty vector (Empty) or PGC1α-overexpression (PGC1α) plasmids were cultured for 6 days. OCR ( a , n = 10 tests) and SRC and mitochondrial ATP production ( b , n = 10 tests) were measured. c - e , Tumour weights ( c ), absolute numbers of transferred CD8 + TILs ( d ), and proportion of damaged mitochondria in transferred CD8 + TILs ( e ) were assessed in the indicated groups (n = 6 mice), related to Fig. . f - i , Experimental design related to Fig. ( f ), tumour weights ( g ), absolute numbers of total ( h ) and Tpex (Ly108 + TIM-3 − ) and Tex term (Ly108 − TIM-3 + ) subsets ( i ) of transferred CD8 + TILs among the five groups at day 14 after ACT (n = 6 mice). j - n , CD8 + OT-I T cells transduced with either TOX-overexpressing (TOX-OE) or Empty vector (Control) retrovirus were cultured for 5 days in vitro, and then restimulated with or without CD3 antibody for 24 h before analysis. Representative plots and quantification of mitochondrial depolarization (TMRE/MTG) lo ( j ) and MitoSOX level ( k ) were assessed (n = 3 independent samples). OCR ( l ), SRC (left) and mitochondrial ATP production (right) ( m ), and glycoPER ( n ) were measured (n = 10 tests). o , p , Activated WT and KO CD8 + OT-I T cells were transduced with either shCtrl or shTox retrovirus at 24 h post-activation and cultured for an additional 5 days prior to analysis. OCR ( o ), SRC (left) and mitochondrial ATP production (right) ( p ) were measured (n = 8 tests). Diagram in f created in BioRender. Li, G. (2025) https://BioRender.com/md3c1bz . Data in ( f - i ) are representative of two independent experiments. Data are presented as mean ± s.e.m. Statistical analyses were determined by two-way ANOVA with Tukey’s multiple-comparisons test ( a - e , g - p ). * P < 0.05, ** P < 0.01, *** P < 0.001, and **** P < 0.0001; ns, not significant.

    Article Snippet: The MESV- shCtrl -GFP (Addgene, 85587) was used for Tox or Pgam5 KD.

    Techniques: Transduction, Plasmid Preparation, Over Expression, Cell Culture, Control, In Vitro, Activation Assay

    a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Journal: bioRxiv

    Article Title: Concerted remodelling of the postsynaptic spine and RNA granule by cLTP

    doi: 10.1101/2025.07.16.665171

    Figure Lengend Snippet: a , Experimental design of biotinylation assays in cortical neurons under basal, cLTP and post-cLTP conditions. b , A representative αFLAG immunofluorescence image of cortical neurons expressing FLAG-APEX2 fused to a nuclear export signal sequence from a lentiviral vector. c , Proteomic analysis of streptavidin pulldown and input samples from cortical neurons subject to biotin labelling under basal conditions. d , Pulldown to input ratios as a function of the predicted number of surface tyrosines per protein. e , Volcano plot with enrichment scores for the indicated selection of protein sets (bubble size indicates protein number in each protein set). f , Tyrosine surface exposure in ribosomal proteins with low and high accessibility scores as determined by their streptavidin pulldown / input ratios. g , Accessibility scores corresponding to ribosomal proteins as a function of the number of surface tyrosines hidden in the 80S ribosome under basal (blue) and cLTP (orange) conditions. h , Proteomic analysis of cortical neurons under basal and cLTP conditions. Ribosomal proteins are indicated (red dots).

    Article Snippet: Lentiviral constructs pLKO-RFP-shCtrl (Addgene, 69040) and pLKO-RFP-shDbn1 containing the shRNA sequence GCAGTCTATCTTTGGTGACCA (TRCN0000090077) against the Dbn1 gene were used in knockdown experiments. pFUW-FLAG-APEX2, pFUW-FLAG-APEX2-DBN1 and pFUW-FLAG-APEX2-IGF2BP1 were used to perform accessibility and proximity assays, and derived from pcDNA3 APEX2-NES (Addgene, 49386) and pFUW (Addgene, 14882).

    Techniques: Immunofluorescence, Expressing, Sequencing, Plasmid Preparation, Selection